eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	marfan syndrome

Disease ID	139
Disease	marfan syndrome
Definition	An autosomal dominant disorder of CONNECTIVE TISSUE with abnormal features in the heart, the eye, and the skeleton. Cardiovascular manifestations include MITRAL VALVE PROLAPSE, dilation of the AORTA, and aortic dissection. Other features include lens displacement (ectopia lentis), disproportioned long limbs and enlarged DURA MATER (dural ectasia). Marfan syndrome is associated with mutations in the gene encoding fibrillin, a major element of extracellular microfibrils of connective tissue.
Synonym	marfan syndrome [disease/finding] marfan syndrome, type i marfan's disease marfan's syndrome marfan's syndrome (disorder) marfans syndrome mfs mfs1 syndrome, marfan syndrome, marfan's
Orphanet	ORPHANET:558
OMIM	OMIM:154700
DOID	DOID:14323
UMLS	C0024796
MeSH	D008382
SNOMED-CT	SNOMEDCT_US_2016_09_01:19346006
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:73) C0003486 \| aortic aneurysm \| 9 C0003493 \| aortic disease \| 7 C0023316 \| lens subluxation \| 6 C0878544 \| cardiomyopathy \| 5 C0036439 \| scoliosis \| 5 C0017601 \| glaucoma \| 3 C0042373 \| vascular disease \| 3 C0026267 \| mitral valve prolapse \| 3 C0155746 \| subclavian artery aneurysm \| 2 C2697932 \| loeys-dietz syndrome \| 2 C0003486 \| aortic aneurysms \| 2 C0152021 \| congenital heart disease \| 2 C0524812 \| intracranial hypotension \| 2 C0037315 \| sleep apnea \| 2 C0026265 \| mitral valve disease \| 2 C0007193 \| dilated cardiomyopathy \| 2 C0026266 \| mitral regurgitation \| 2 C0031099 \| periodontitis \| 1 C0002878 \| haemolytic anaemia \| 1 C0003873 \| rheumatoid arthritis \| 1 C0037315 \| sleep apnoea \| 1 C0220704 \| velocardiofacial syndrome \| 1 C0025289 \| meningitis \| 1 C0019291 \| hiatus hernia \| 1 C0238463 \| papillary thyroid carcinoma \| 1 C0015310 \| exotropia \| 1 C0027092 \| myopia \| 1 C0018799 \| heart disease \| 1 C0149931 \| migraine \| 1 C0028754 \| obesity \| 1 C0012736 \| dissecting aortic aneurysm \| 1 C0086543 \| cataract \| 1 C0035309 \| retinal disease \| 1 C0398623 \| thrombophilia \| 1 C0007177 \| pericardial tamponade \| 1 C0023787 \| lipodystrophy \| 1 C0025362 \| mental retardation \| 1 C0520679 \| obstructive sleep apnoea \| 1 C0178879 \| urinary obstruction \| 1 C0022658 \| renal disease \| 1 C0014122 \| infectious endocarditis \| 1 C0221032 \| congenital lipodystrophy \| 1 C0040997 \| trigeminal neuralgia \| 1 C0022661 \| end-stage renal disease \| 1 C0014118 \| endocarditis \| 1 C0018799 \| cardiac disease \| 1 C0162872 \| thoracic aortic aneurysm \| 1 C0003864 \| arthritis \| 1 C0037944 \| spinal stenosis \| 1 C0036529 \| secondary cardiomyopathy \| 1 C0018801 \| heart failure \| 1 C0007222 \| cardiovascular disease \| 1 C0004153 \| atherosclerosis \| 1 C0007115 \| thyroid ca \| 1 C0549473 \| thyroid carcinoma \| 1 C0002871 \| anaemia \| 1 C0155111 \| bullous keratopathy \| 1 C0018924 \| hemarthrosis \| 1 C0079744 \| diffuse large b-cell lymphoma \| 1 C0264716 \| chronic heart failure \| 1 C0162871 \| abdominal aortic aneurysm \| 1 C0006267 \| bronchiectasis \| 1 C0034065 \| pulmonary embolism \| 1 C0162871 \| abdominal aortic aneurysms \| 1 C0235270 \| keratopathy \| 1 C0023418 \| leukemia \| 1 C0032326 \| pneumothorax \| 1 C0520679 \| obstructive sleep apnea \| 1 C0017605 \| angle-closure glaucoma \| 1 C0021843 \| intestinal obstruction \| 1 C0733682 \| x-linked hypophosphatemia \| 1 C0003076 \| aniridia \| 1 C0033847 \| pseudoxanthoma elasticum \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:11) 2200 \| FBN1 \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT 1278 \| COL1A2 \| UNIPROT 4843 \| NOS2 \| CTD_human 4053 \| LTBP2 \| CLINVAR 6647 \| SOD1 \| CTD_human 6648 \| SOD2 \| CTD_human 4318 \| MMP9 \| CTD_human 847 \| CAT \| CTD_human 7048 \| TGFBR2 \| CLINVAR;CTD_human;UNIPROT 4313 \| MMP2 \| CTD_human 3915 \| LAMC1 \| CTD_human
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:10) 2200 \| FBN1 \| CIPHER;CTD_human 7046 \| TGFBR1 \| CIPHER 7048 \| TGFBR2 \| CIPHER;CTD_human 4843 \| NOS2 \| CTD_human 3915 \| LAMC1 \| CTD_human 4313 \| MMP2 \| CTD_human 4318 \| MMP9 \| CTD_human 847 \| CAT \| CTD_human 6648 \| SOD2 \| CTD_human 6647 \| SOD1 \| CTD_human
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:29) 186 \| AGTR2 \| 1.879 \| DISEASES 633 \| BGN \| 1.226 \| DISEASES 1745 \| DLX1 \| 2.53 \| DISEASES 22909 \| FAN1 \| 1.005 \| DISEASES 2200 \| FBN1 \| 7.069 \| DISEASES 53827 \| FXYD5 \| 1.462 \| DISEASES 5654 \| HTRA1 \| 1.502 \| DISEASES 54900 \| LAX1 \| 1.337 \| DISEASES 4052 \| LTBP1 \| 2.294 \| DISEASES 8076 \| MFAP5 \| 2.823 \| DISEASES 4607 \| MYBPC3 \| 1.403 \| DISEASES 4629 \| MYH11 \| 1.614 \| DISEASES 4638 \| MYLK \| 1.554 \| DISEASES 93649 \| MYOCD \| 1.779 \| DISEASES 23218 \| NBEAL2 \| 2.812 \| DISEASES 4771 \| NF2 \| 1.439 \| DISEASES 5034 \| P4HB \| 1.33 \| DISEASES 5214 \| PFKP \| 2.317 \| DISEASES 648791 \| PPP1R3G \| 4.153 \| DISEASES 5962 \| RDX \| 1.417 \| DISEASES 4088 \| SMAD3 \| 2.373 \| DISEASES 6525 \| SMTN \| 2.237 \| DISEASES 6677 \| SPAM1 \| 2.15 \| DISEASES 7046 \| TGFBR1 \| 1.897 \| DISEASES 7048 \| TGFBR2 \| 2.879 \| DISEASES 7068 \| THRB \| 1.246 \| DISEASES 11277 \| TREX1 \| 1.66 \| DISEASES 286753 \| TUSC5 \| 1.595 \| DISEASES 26036 \| ZNF451 \| 2.487 \| DISEASES
Locus	(Waiting for update.)

Disease ID	139
Disease	marfan syndrome
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:59) HP:0002636 \| Aneurysm of an abdominal artery HP:0001065 \| Striae distensae HP:0002108 \| Spontaneous pneumothorax HP:0000541 \| Retinal detachment HP:0000545 \| Myopia HP:0001166 \| Arachnodactyly HP:0001519 \| Disproportionate tall stature HP:0005294 \| Arterial dissection HP:0001533 \| Slender build HP:0012432 \| Chronic fatigue HP:0000678 \| Dental crowding HP:0007676 \| Hypoplasia of the iris HP:0004933 \| Ascending aortic dissection HP:0000767 \| Pectus excavatum HP:0003302 \| Spondylolisthesis HP:0001635 \| Congestive heart failure HP:0012369 \| Malar anomaly HP:0000347 \| Micrognathia HP:0003326 \| Myalgia HP:0007720 \| Flat cornea HP:0002996 \| Limited elbow movement HP:0006687 \| Aortic tortuosity HP:0100775 \| Dural ectasia HP:0002097 \| Emphysema HP:0002435 \| Meningocele HP:0002105 \| Hemoptysis HP:0012019 \| Lens luxation HP:0000494 \| Downslanted palpebral fissures HP:0000175 \| Cleft palate HP:0000275 \| Narrow face HP:0002650 \| Scoliosis HP:0003179 \| Protrusio acetabuli HP:0000938 \| Osteopenia HP:0000939 \| Osteoporosis HP:0002808 \| Kyphosis HP:0007018 \| Attention deficit hyperactivity disorder HP:0000268 \| Dolichocephaly HP:0000023 \| Inguinal hernia HP:0002360 \| Sleep disturbance HP:0002705 \| High, narrow palate HP:0000278 \| Retrognathia HP:0004927 \| Pulmonary artery dilatation HP:0004326 \| Cachexia HP:0001382 \| Joint hypermobility HP:0001083 \| Ectopia lentis HP:0001634 \| Mitral valve prolapse HP:0000505 \| Visual impairment HP:0005059 \| Arthralgia/arthritis HP:0001132 \| Lens subluxation HP:0007800 \| Increased axial globe length HP:0010807 \| Open bite HP:0001763 \| Pes planus HP:0001252 \| Muscular hypotonia HP:0012499 \| Descending aortic dissection HP:0000501 \| Glaucoma HP:0000768 \| Pectus carinatum HP:0005111 \| Dilatation of the ascending aorta HP:0003202 \| Skeletal muscle atrophy HP:0004382 \| Mitral valve calcification
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:88) HP:0002617 \| Aneurysmal dilatation \| 38 HP:0002647 \| Aortic dissection \| 23 HP:0001083 \| Dislocated lenses \| 14 HP:0004942 \| Aortic aneurysm \| 9 HP:0100775 \| Dural ectasia \| 7 HP:0001132 \| Lens subluxation \| 6 HP:0002650 \| Scoliosis \| 5 HP:0001638 \| Cardiomyopathy \| 5 HP:0000767 \| Funnel chest \| 3 HP:0010535 \| Sleep apnea \| 3 HP:0001724 \| Aortic dilatation \| 3 HP:0000501 \| Glaucoma \| 3 HP:0002104 \| Absence of spontaneous respiration \| 3 HP:0001634 \| Mitral valve prolapse \| 3 HP:0000924 \| Abnormality of the skeletal system \| 3 HP:0100790 \| Hernia \| 3 HP:0001647 \| Bicuspid aortic valve \| 2 HP:0012641 \| Decreased intracranial pressure \| 2 HP:0002615 \| Low blood pressure \| 2 HP:0001653 \| Mitral valve insufficiency \| 2 HP:0002315 \| Headaches \| 2 HP:0001644 \| Congestive cardiomyopathy \| 2 HP:0001297 \| Cerebral vascular events \| 2 HP:0012180 \| Arterial cystic medial necrosis \| 2 HP:0006702 \| Spontaneous coronary artery dissection \| 1 HP:0100584 \| Endocarditis \| 1 HP:0002097 \| Pulmonary emphysema \| 1 HP:0004610 \| Narrow lumbar spinal canal \| 1 HP:0004953 \| Abdominal aortic aneurysm \| 1 HP:0005214 \| Bowel obstruction \| 1 HP:0002622 \| Dissecting aortic aneurysm \| 1 HP:0000545 \| Near sightedness \| 1 HP:0002119 \| Ventricular dilatation \| 1 HP:0004927 \| Pulmonary artery dilatation \| 1 HP:0003418 \| Back pain \| 1 HP:0012378 \| Fatigue \| 1 HP:0000518 \| Cataract \| 1 HP:0003419 \| Low back pain \| 1 HP:0002664 \| Neoplasia \| 1 HP:0002907 \| Microhematuria \| 1 HP:0100719 \| Lens coloboma \| 1 HP:0011003 \| High myopia \| 1 HP:0001249 \| Mental retardation \| 1 HP:0001645 \| Sudden cardiac death \| 1 HP:0000589 \| Ocular coloboma \| 1 HP:0001238 \| Slender fingers \| 1 HP:0012531 \| Pain \| 1 HP:0001369 \| Arthritis \| 1 HP:0003416 \| Spinal canal stenosis \| 1 HP:0012727 \| Thoracic aortic aneurysm \| 1 HP:0002140 \| Ischemic stroke \| 1 HP:0002076 \| Migraine headaches \| 1 HP:0001878 \| Haemolytic anaemia \| 1 HP:0005261 \| Joint hemorrhage \| 1 HP:0003179 \| Protrusio acetabulae \| 1 HP:0001649 \| Tachycardia \| 1 HP:0002870 \| Obstructive sleep apnea \| 1 HP:0001287 \| Meningitis \| 1 HP:0100724 \| Hypercoagulability \| 1 HP:0002107 \| Collapsed lung \| 1 HP:0009125 \| Lipodystrophy \| 1 HP:0004308 \| Ventricular arrhythmia \| 1 HP:0000526 \| Absent iris \| 1 HP:0001909 \| Leukemia \| 1 HP:0002036 \| Hiatus hernia \| 1 HP:0001903 \| Anemia \| 1 HP:0002204 \| Pulmonary embolism \| 1 HP:0001370 \| Rheumatoid arthritis \| 1 HP:0004937 \| Pulmonary artery aneurysm \| 1 HP:0002631 \| Ascending aortic aneurysm \| 1 HP:0011675 \| Arrhythmias \| 1 HP:0000275 \| Decreased width of face \| 1 HP:0001643 \| Persistent ductus arteriosus \| 1 HP:0000766 \| Pectus deformity \| 1 HP:0001513 \| Obesity \| 1 HP:0000020 \| Bladder incontinence \| 1 HP:0000577 \| Exotropia \| 1 HP:0002895 \| Papillary thyroid carcinoma \| 1 HP:0003774 \| End-stage renal failure \| 1 HP:0001166 \| Long, slender fingers \| 1 HP:0002890 \| Thyroid carcinoma \| 1 HP:0000704 \| Pyorrhea \| 1 HP:0002621 \| Atherosclerosis \| 1 HP:0002110 \| Bronchiectasis \| 1 HP:0011645 \| Aneurysm of the aortic sinus \| 1 HP:0100661 \| Trigeminal neuralgia \| 1 HP:0001635 \| Congestive heart failure \| 1 HP:0002751 \| Kyphoscoliosis \| 1

Disease ID	139
Disease	marfan syndrome
Manually Symptom	UMLS \| Name(Total Manually Symptoms:97) C2712322 \| tachycardia C2678504 \| osteoporosis C2598155 \| pain C2364133 \| infection C2364051 \| fatigue C2242765 \| spondylolisthesis C2096315 \| headache C2072946 \| aortic aneurysm C2046121 \| aortic dissection C1963229 \| retinal detachment C1963215 \| pneumothorax C1962986 \| glaucoma C1962971 \| myocarditis C1962958 \| hematoma C1961102 \| acute lymphoblastic leukemia C1866956 \| aortic root dilation C1555769 \| pulmonary disease C1555754 \| cardiovascular disease C1541923 \| infective endocarditis C1402315 \| vascular lesions C1393529 \| vascular complications C1298820 \| aortic root aneurysm C1261470 \| meningocele C1260873 \| aortic valve disease C0948187 \| tracheomalacia C0948089 \| acute coronary syndrome C0856747 \| ascending aortic aneurysm C0796140 \| rutherfurd syndrome C0751731 \| spontaneous intracranial hypotension C0751001 \| basilar artery aneurysm C0743323 \| acute dyspnea C0742215 \| cervical spine subluxation C0741949 \| cardiovascular pathology C0700361 \| distress C0700208 \| scoliosis C0524812 \| intracranial hypotension C0427008 \| stiffness C0398623 \| hypercoagulability C0376293 \| stigmata C0345050 \| annuloaortic ectasia C0345050 \| annulo-aortic ectasia C0344954 \| ventricular septal aneurysm C0268731 \| glomerular disease C0265010 \| ruptured thoracic aortic aneurysm C0264967 \| extracranial internal carotid artery aneurysm C0263445 \| acne fulminans C0243050 \| cardiovascular abnormalities C0238669 \| aortic root dilatation C0231667 \| wrist sign C0162872 \| thoracic aortic aneurysms C0162872 \| thoracic aortic aneurysm C0162871 \| abdominal aortic aneurysm C0155746 \| subclavian artery aneurysm C0149931 \| migraine C0149781 \| spontaneous pneumothorax C0078981 \| arachnoid cyst C0042373 \| vascular disease C0041327 \| pulmonary tuberculosis C0040961 \| tricuspid regurgitation C0039496 \| temporomandibular joint dysfunction C0039070 \| syncope C0037763 \| spasm C0035305 \| retinal detachments C0034067 \| pulmonary emphysema C0033847 \| pseudoxanthoma elasticum C0032962 \| complication of pregnancy C0027765 \| neurological disorders C0027092 \| myopia C0026267 \| mitral valve prolapse C0026266 \| mitral regurgitation C0026266 \| mitral insufficiency C0023418 \| leukemia C0023316 \| subluxation of lens C0022679 \| cystic kidneys C0022658 \| renal disease C0020546 \| hypertensive crisis C0020545 \| renovascular hypertension C0020302 \| buphthalmos C0019555 \| developmental dysplasia of the hip C0019270 \| hernia C0019077 \| hemopneumothorax C0018799 \| heart disease C0016842 \| pectus excavatum C0012736 \| dissecting aortic aneurysm C0011401 \| pulp calcifications C0010051 \| coronary artery aneurysm C0007820 \| cerebrovascular disorders C0007222 \| cardiovascular disorders C0003504 \| aortic regurgitation C0003504 \| aortic insufficiency C0003493 \| aortic diseases C0003493 \| aortic disease C0003486 \| aortic aneurysms C0002949 \| dissecting aneurysm C0002940 \| aneurysms C0002940 \| aneurysm C0001363 \| acute mesenteric ischemia
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:38) C0002940 \| aneurysm \| 27 C0340643 \| aortic dissection \| 23 C0002940 \| aneurysms \| 11 C0003486 \| aortic aneurysm \| 8 C0003493 \| aortic disease \| 7 C1298820 \| aortic root aneurysm \| 6 C1866956 \| aortic root dilation \| 5 C0036439 \| scoliosis \| 5 C0017601 \| glaucoma \| 3 C0016842 \| pectus excavatum \| 3 C0042373 \| vascular disease \| 3 C1393529 \| vascular complications \| 3 C0026267 \| mitral valve prolapse \| 3 C0155746 \| subclavian artery aneurysm \| 2 C0019270 \| hernia \| 2 C0026266 \| mitral regurgitation \| 2 C0018681 \| headache \| 2 C0427008 \| stiffness \| 2 C0231667 \| wrist sign \| 1 C0039231 \| tachycardia \| 1 C0015672 \| fatigue \| 1 C0027092 \| myopia \| 1 C0162871 \| abdominal aortic aneurysm \| 1 C0524812 \| intracranial hypotension \| 1 C0162872 \| thoracic aortic aneurysm \| 1 C0020649 \| hypotension \| 1 C0012736 \| dissecting aortic aneurysm \| 1 C0856747 \| ascending aortic aneurysm \| 1 C0037315 \| sleep apnea \| 1 C0340649 \| iliac artery dissection \| 1 C0033847 \| pseudoxanthoma elasticum \| 1 C0007222 \| cardiovascular disease \| 1 C0018799 \| heart disease \| 1 C0030193 \| pain \| 1 C0751731 \| spontaneous intracranial hypotension \| 1 C0149931 \| migraine \| 1 C0003486 \| aortic aneurysms \| 1 C0032326 \| pneumothorax \| 1

Manually Genotype(Total Manually Genotypes:1)
Gene	Mutation	DOI	Article Title
FBN1	-	doi:10.1038/gim.2015.51	Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:271)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs111231312	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48468070	G	A
rs111401431	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48468097	G	A
rs111588631	21542060	2200	FBN1	umls:C0024796	UNIPROT	In a first stage, genomic DNA from five MFS or LDS patient samples with previously identified mutations and/or polymorphisms in FBN1 and TGFBR1 and 2 were analyzed and revealed all expected variants.	0.722695299	2011	NA	NA	NA	NA	NA
rs111671429	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48596311	G	C,A
rs111687884	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48537704	G	C,A
rs111801777	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48489875	T	C
rs111856492	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48415695	C	T,A
rs111929350	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	NA	NA	NA	NA	NA
rs111929350	11700157	2200	FBN1	umls:C0024796	UNIPROT	Genotype and phenotype analysis of 171 patients referred for molecular study of the fibrillin-1 gene FBN1 because of suspected Marfan syndrome.	0.722695299	2001	NA	NA	NA	NA	NA
rs112202622	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48490079	C	T,G,A
rs112287730	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48489977	C	T
rs112289537	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48516299	G	-
rs112375043	21542060	2200	FBN1	umls:C0024796	UNIPROT	In a first stage, genomic DNA from five MFS or LDS patient samples with previously identified mutations and/or polymorphisms in FBN1 and TGFBR1 and 2 were analyzed and revealed all expected variants.	0.722695299	2011	FBN1	15	48472594	G	C,A
rs112645512	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48516225	G	A
rs112660651	11700157	2200	FBN1	umls:C0024796	UNIPROT	Genotype and phenotype analysis of 171 patients referred for molecular study of the fibrillin-1 gene FBN1 because of suspected Marfan syndrome.	0.722695299	2001	FBN1	15	48610808	C	G,A
rs112660651	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48610808	C	G,A
rs112728248	16222657	2200	FBN1	umls:C0024796	UNIPROT	Identification of sixty-two novel and twelve known FBN1 mutations in eighty-one unrelated probands with Marfan syndrome and other fibrillinopathies.	0.722695299	2005	NA	NA	NA	NA	NA
rs112836174	NA	2200	FBN1	umls:C0024796	UNIPROT	NA	0.722695299	NA	NA	NA	NA	NA	NA
rs112989722	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48437347	G	C,A
rs113001196	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	NA	NA	NA	NA	NA
rs113086760	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	NA	NA	NA	NA	NA
rs113249837	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	NA	NA	NA	NA	NA
rs113422242	10874320	2200	FBN1	umls:C0024796	BeFree	Enzymatic mutation detection (EMD) of novel mutations (R565X and R1523X) in the FBN1 gene of patients with Marfan syndrome using T4 endonuclease VII.	0.722695299	2000	NA	NA	NA	NA	NA
rs113544411	16222657	2200	FBN1	umls:C0024796	UNIPROT	Identification of sixty-two novel and twelve known FBN1 mutations in eighty-one unrelated probands with Marfan syndrome and other fibrillinopathies.	0.722695299	2005	NA	NA	NA	NA	NA
rs113812345	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48513591	G	A
rs113871094	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48465820	G	A
rs113905529	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48596328	G	C,A
rs137854456	1852208	2200	FBN1	umls:C0024796	UNIPROT	Marfan syndrome caused by a recurrent de novo missense mutation in the fibrillin gene.	0.722695299	1991	FBN1	15	48487365	C	T,G,A
rs137854457	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48428423	C	T,G
rs137854457	1301946	2200	FBN1	umls:C0024796	UNIPROT	Clustering of fibrillin (FBN1) missense mutations in Marfan syndrome patients at cysteine residues in EGF-like domains.	0.722695299	1992	FBN1	15	48428423	C	T,G
rs137854458	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48483910	C	G
rs137854458	1301946	2200	FBN1	umls:C0024796	UNIPROT	Clustering of fibrillin (FBN1) missense mutations in Marfan syndrome patients at cysteine residues in EGF-like domains.	0.722695299	1992	FBN1	15	48483910	C	G
rs137854459	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48463977	A	G
rs137854459	1301946	2200	FBN1	umls:C0024796	UNIPROT	Clustering of fibrillin (FBN1) missense mutations in Marfan syndrome patients at cysteine residues in EGF-like domains.	0.722695299	1992	FBN1	15	48463977	A	G
rs137854460	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48432943	C	G
rs137854460	1301946	2200	FBN1	umls:C0024796	UNIPROT	Clustering of fibrillin (FBN1) missense mutations in Marfan syndrome patients at cysteine residues in EGF-like domains.	0.722695299	1992	FBN1	15	48432943	C	G
rs137854461	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48437026	T	C
rs137854461	16220557	2200	FBN1	umls:C0024796	UNIPROT	Identification of 29 novel and nine recurrent fibrillin-1 (FBN1) mutations and genotype-phenotype correlations in 76 patients with Marfan syndrome.	0.722695299	2005	FBN1	15	48437026	T	C
rs137854462	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48510115	T	A
rs137854462	8406497	2200	FBN1	umls:C0024796	UNIPROT	Four novel FBN1 mutations: significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome.	0.722695299	1993	FBN1	15	48510115	T	A
rs137854463	8406497	2200	FBN1	umls:C0024796	UNIPROT	Four novel FBN1 mutations: significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome.	0.722695299	1993	FBN1	15	48497391	T	G
rs137854463	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48497391	T	G
rs137854465	8136837	2200	FBN1	umls:C0024796	UNIPROT	Interestingly, the neonatal MFS mutations are clustered in one particular region of FBN1, possibly providing new insights into genotype-phenotype comparisons.	0.722695299	1994	FBN1	15	48488230	A	G
rs137854466	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411280	G	C,A
rs137854467	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48600217	G	A
rs137854467	11700157	2200	FBN1	umls:C0024796	UNIPROT	Genotype and phenotype analysis of 171 patients referred for molecular study of the fibrillin-1 gene FBN1 because of suspected Marfan syndrome.	0.722695299	2001	FBN1	15	48600217	G	A
rs137854468	7762551	2200	FBN1	umls:C0024796	UNIPROT	Ascending aortic disease, ranging from mild aortic root enlargement to aneurysm and/or dissection, has been identified in 10 individuals of a kindred, none of whom had classical Marfan syndrome (MFS).	0.722695299	1995	FBN1	15	48487396	C	T
rs137854468	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487396	C	T
rs137854469	8071963	2200	FBN1	umls:C0024796	UNIPROT	A new missense mutation of fibrillin in a patient with Marfan syndrome.	0.722695299	1994	FBN1	15	48485418	C	T
rs137854469	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48485418	C	T
rs137854470	14695540	2200	FBN1	umls:C0024796	UNIPROT	Detection of thirty novel FBN1 mutations in patients with Marfan syndrome or a related fibrillinopathy.	0.722695299	2004	FBN1	15	48487425	C	T
rs137854470	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487425	C	T
rs137854471	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48483931	C	T
rs137854471	8136837	2200	FBN1	umls:C0024796	UNIPROT	Interestingly, the neonatal MFS mutations are clustered in one particular region of FBN1, possibly providing new insights into genotype-phenotype comparisons.	0.722695299	1994	FBN1	15	48483931	C	T
rs137854472	NA	2200	FBN1	umls:C0024796	UNIPROT	NA	0.722695299	NA	FBN1	15	48488448	T	C
rs137854473	NA	2200	FBN1	umls:C0024796	UNIPROT	NA	0.722695299	NA	FBN1	15	48487384	T	A
rs137854474	9837823	2200	FBN1	umls:C0024796	UNIPROT	A third family cosegregates mild mitral valve prolapse syndrome with a mutation in FBN1 that can be functionally distinguished from those associated with the classic MFS phenotype.	0.722695299	1998	FBN1	15	48483863	A	G
rs137854474	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48483863	A	G
rs137854475	7870075	2200	FBN1	umls:C0024796	UNIPROT	Mutations of the fibrillin gene (FBN1) are known to cause classical Marfan's syndrome, ectopia lentis and neonatal Marfan's syndrome.	0.722695299	1994	FBN1	15	48487155	C	T
rs137854475	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487155	C	T
rs137854476	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48513552	G	A
rs137854477	10441597	2200	FBN1	umls:C0024796	UNIPROT	Demonstration of the recurrence of Marfan-like skeletal and cardiovascular manifestations due to germline mosaicism for an FBN1 mutation.	0.722695299	1999	FBN1	15	48489979	C	T
rs137854478	7611299	2200	FBN1	umls:C0024796	UNIPROT	Fifteen novel FBN1 mutations causing Marfan syndrome detected by heteroduplex analysis of genomic amplicons.	0.722695299	1995	FBN1	15	48488233	C	T
rs137854479	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48497298	T	C
rs137854480	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48537629	G	A
rs137854480	11700157	2200	FBN1	umls:C0024796	UNIPROT	Genotype and phenotype analysis of 171 patients referred for molecular study of the fibrillin-1 gene FBN1 because of suspected Marfan syndrome.	0.722695299	2001	FBN1	15	48537629	G	A
rs137854482	10425041	2200	FBN1	umls:C0024796	UNIPROT	Identification of 9 novel FBN1 mutations in German patients with Marfan syndrome.	0.722695299	1999	FBN1	15	48487389	C	T
rs137854482	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487389	C	T
rs137854483	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48485424	C	T
rs137854855	NA	4053	LTBP2	umls:C0024796	CLINVAR	NA	0.120271442	NA	LTBP2	14	74551108	G	A
rs140537304	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48427699	C	T
rs140592	NA	2200	FBN1	umls:C0024796	UNIPROT	NA	0.722695299	NA	FBN1	15	48489947	A	G
rs140593	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48489896	C	T,G
rs140593	11700157	2200	FBN1	umls:C0024796	UNIPROT	Genotype and phenotype analysis of 171 patients referred for molecular study of the fibrillin-1 gene FBN1 because of suspected Marfan syndrome.	0.722695299	2001	FBN1	15	48489896	C	T,G
rs140598	9150726	2200	FBN1	umls:C0024796	BeFree	The pathogenicity of the Pro1148Ala substitution in the FBN1 gene: causing or predisposing to Marfan syndrome and aortic aneurysm, or clinically innocent?	0.722695299	1997	FBN1	15	48487333	G	C
rs140599	14695540	2200	FBN1	umls:C0024796	UNIPROT	Detection of thirty novel FBN1 mutations in patients with Marfan syndrome or a related fibrillinopathy.	0.722695299	2004	FBN1	15	48487317	C	T
rs140603	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48503845	G	C,A
rs140603	12203992	2200	FBN1	umls:C0024796	UNIPROT	TGGE screening of the entire FBN1 coding sequence in 126 individuals with marfan syndrome and related fibrillinopathies.	0.722695299	2002	FBN1	15	48503845	G	C,A
rs140954477	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48490006	C	T
rs141133182	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48415735	C	T
rs141133182	11700157	2200	FBN1	umls:C0024796	UNIPROT	Genotype and phenotype analysis of 171 patients referred for molecular study of the fibrillin-1 gene FBN1 because of suspected Marfan syndrome.	0.722695299	2001	FBN1	15	48415735	C	T
rs145942328	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48613072	C	T
rs146726731	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48520779	C	T
rs147195031	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48420780	G	A
rs148076256	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48489907	G	C
rs148831709	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48428373	C	T
rs149062442	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48415588	C	T
rs191989961	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48474614	C	T
rs193921256	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495575	G	T,A
rs193922179	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48510124	C	T
rs193922181	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48510080	-	CGCATTACA
rs193922182	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48510049	C	-
rs193922183	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48510048	A	T
rs193922185	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48505037	G	A
rs193922186	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48503843	G	T
rs193922187	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48497373	A	-
rs193922188	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48496150	C	G
rs193922189	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495529	A	G
rs193922190	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495500	A	T
rs193922191	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495258	T	G
rs193922193	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495123	C	G
rs193922194	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48494250	G	-
rs193922197	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48488435	GG	-
rs193922198	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48488383	C	-
rs193922199	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487186	C	A
rs193922203	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48474300	A	C
rs193922204	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48468542	C	T
rs193922205	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48468527	A	T
rs193922206	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48596367	T	A
rs193922207	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48468001	A	T
rs193922210	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48596337	C	T
rs193922212	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48452579	GAGGTGAA	-
rs193922214	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48448887	T	C
rs193922215	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48537791	A	G
rs193922216	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48448768	C	G
rs193922218	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1;LOC105370809	15	48644714	G	A
rs193922219	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48446701	C	T,A
rs193922220	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48444565	-	GTATCCA
rs193922223	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48437072	C	A
rs193922224	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48537698	A	C
rs193922225	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48434653	-	CAAT
rs193922226	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48432901	C	-
rs193922227	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48430741	-	TTCTTGCA
rs193922228	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48430736	A	G
rs193922230	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48425840	T	G,C
rs193922233	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48425410	G	C
rs193922234	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48421591	A	C
rs193922235	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48421579	G	-
rs193922236	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48420700	C	T
rs193922239	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48415708	C	T
rs193922240	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48415689	C	G
rs193922241	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48412592	C	-
rs193922245	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1;LOC105370809	15	48644687	T	C
rs193922246	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411189	ATTTTA	-
rs199474693	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48600196	A	C
rs200309328	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48412715	G	A,C
rs201273753	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48472617	G	C
rs25403	12203992	2200	FBN1	umls:C0024796	UNIPROT	TGGE screening of the entire FBN1 coding sequence in 126 individuals with marfan syndrome and related fibrillinopathies.	0.722695299	2002	FBN1	15	48613073	G	A
rs25403	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48613073	G	A
rs25404	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48613009	C	T
rs267606796	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411338	C	T
rs267606797	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48437362	A	C
rs267606798	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48465825	C	T
rs363804	16220557	2200	FBN1	umls:C0024796	UNIPROT	Identification of 29 novel and nine recurrent fibrillin-1 (FBN1) mutations and genotype-phenotype correlations in 76 patients with Marfan syndrome.	0.722695299	2005	FBN1	15	48441771	C	T
rs363807	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48445430	G	A
rs363815	11826022	2200	FBN1	umls:C0024796	UNIPROT	These results indicate that CSGE is highly sensitive for the detection of mutations in FBN1, and that molecular diagnostics is a useful means of confirming clinical diagnoses of MFS and related disorders.	0.722695299	2002	FBN1	15	48437370	A	G
rs363853	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48596292	A	G
rs363853	16222657	2200	FBN1	umls:C0024796	UNIPROT	Identification of sixty-two novel and twelve known FBN1 mutations in eighty-one unrelated probands with Marfan syndrome and other fibrillinopathies.	0.722695299	2005	FBN1	15	48596292	A	G
rs397514558	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48490013	G	A
rs397515753	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48520755	G	A
rs397515754	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48516318	T	A
rs397515755	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48520711	G	T
rs397515756	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48516364	T	C
rs397515757	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48515382	C	T
rs397515758	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48513575	CT	-
rs397515759	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48510157	C	T
rs397515762	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48508581	C	A
rs397515765	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48497317	A	G
rs397515766	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48496178	A	G
rs397515767	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48613018	C	T
rs397515768	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48496112	T	A
rs397515769	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48496106	AT	-
rs397515770	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495561	C	G
rs397515771	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495560	G	C
rs397515773	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495520	A	C
rs397515774	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495519	C	G
rs397515775	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495513	C	T
rs397515776	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48495512	A	C
rs397515778	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48610805	CC	G
rs397515779	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48494240	-	A
rs397515781	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48492482	C	-
rs397515782	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48610775	C	A
rs397515784	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48489921	G	C
rs397515785	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1;LOC105370809	15	48644730	TAAATCCCAGG	-
rs397515786	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48488412	C	T
rs397515788	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48488176	C	-
rs397515789	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48488112	C	T
rs397515790	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487383	T	C
rs397515791	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487362	C	A
rs397515792	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487311	C	A
rs397515793	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487075	C	T,G
rs397515794	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48600213	C	T
rs397515796	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48481771	T	G
rs397515797	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48481733	A	G
rs397515798	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48474599	C	G
rs397515799	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48474567	A	T
rs397515801	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48474305	T	C
rs397515802	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48472665	A	G
rs397515803	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48472628	CACTGGCCA	-
rs397515804	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48472628	C	T
rs397515805	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48470726	C	T,G
rs397515807	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48470729	A	C
rs397515808	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48470687	C	T,G
rs397515810	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48468489	C	T
rs397515811	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48468463	A	G
rs397515812	10874320	2200	FBN1	umls:C0024796	BeFree	Enzymatic mutation detection (EMD) of novel mutations (R565X and R1523X) in the FBN1 gene of patients with Marfan syndrome using T4 endonuclease VII.	0.722695299	2000	FBN1	15	48468427	G	A
rs397515812	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48468427	G	A
rs397515814	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48465573	C	T
rs397515816	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48465568	C	T
rs397515817	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48464009	C	T
rs397515818	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48596324	C	G
rs397515819	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48463241	C	G
rs397515820	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48460291	G	A
rs397515821	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48452670	G	A
rs397515823	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48452595	C	A
rs397515825	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48537786	A	-
rs397515826	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48446773	G	C
rs397515827	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48446747	C	T
rs397515828	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48445453	C	T
rs397515829	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48445424	G	A
rs397515830	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48441765	C	T
rs397515831	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48437792	C	A
rs397515833	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48437321	C	T
rs397515834	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48434694	AA	C
rs397515835	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	NA	NA	NA	NA	NA
rs397515836	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48432975	A	C
rs397515837	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48432949	A	G
rs397515840	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48430701	G	A
rs397515845	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48427677	C	T
rs397515846	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48427603	AG	-
rs397515847	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48427603	A	G
rs397515848	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48427591	G	A
rs397515851	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48425368	C	A
rs397515852	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48422024	AT	-
rs397515853	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48421677	T	G
rs397515854	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48421651	C	T
rs397515859	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48415632	C	T
rs397515861	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411339	C	T
rs397515863	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411228	T	C
rs397515864	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411123	G	C
rs397515865	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411006	T	G
rs397515866	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411000	AA	-
rs397515867	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1;LOC105370808	15	48526159	-	A
rs397516493	NA	7048	TGFBR2	umls:C0024796	CLINVAR	NA	0.260236045	NA	TGFBR2	3	30688458	GTGTTGAGAGAT	-
rs398122831	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48412639	TT	-
rs398122832	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48412620	TTTGGGGTAGCCATTGATCT	-
rs398122833	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48412568	C	A
rs398122934	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48472628	CACTGGC	-
rs587782944	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48513641	C	T
rs587782946	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48470688	G	A
rs587782947	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48446711	C	A
rs587782948	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411085	C	A
rs61746008	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48412619	G	A,C
rs61746008	7738200	2200	FBN1	umls:C0024796	UNIPROT	A mutation in FBN1 disrupts profibrillin processing and results in isolated skeletal features of the Marfan syndrome.	0.722695299	1995	FBN1	15	48412619	G	A,C
rs61746008	19396033	2200	FBN1	umls:C0024796	BeFree	Primary protrusio acetabuli may represent a hitherto unidentified metabolic defect, and a possible candidate for such genetic influence is the R2726W variant of the fibrillin 1 (FBN1) gene, which segregates with isolated skeletal features of individuals with Marfan syndrome.	0.722695299	2009	FBN1	15	48412619	G	A,C
rs672601352	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48516343	GCACAGCTTGTT	-
rs727503054	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48420752	A	G
rs727503056	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48467967	GGAGTACCCCAGGCTTTACCCAGAGAACAGCAGCAGGAAGCTTT	-
rs727503057	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48505106	G	A
rs727503058	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1;LOC105370809	15	48644604	A	G
rs727504315	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48445405	T	-
rs727504347	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48463240	T	-
rs727504410	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48428457	G	A
rs727504411	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487118	G	T
rs727504454	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411131	TCC	-
rs727504651	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48411340	AA	TCCT
rs727505006	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48487402	G	A
rs727505110	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48489991	C	G
rs727505269	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48537687	G	-
rs730880097	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1;LOC105370809	15	48644769	T	C
rs730880098	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48610793	C	A
rs730880099	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48510125	G	A
rs730880100	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48488445	C	T
rs730880101	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48470640	A	G
rs730880103	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48460262	A	T
rs730880104	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48445432	A	C
rs730880105	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48503785	A	G
rs730880106	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48474254	C	T
rs730880107	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48432864	A	T
rs730880108	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48610753	TA	-
rs730880356	NA	2200	FBN1	umls:C0024796	CLINVAR	NA	0.722695299	NA	FBN1	15	48515519	-	C

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:16)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0000175	Cleft palate	MP:0013550	abnormal secondary palate morphology
HP:0004927	Pulmonary artery dilatation	MP:0006133	calcified artery	pathologic deposition of calcium salts in the arteries
HP:0005111	Dilatation of the ascending aorta	MP:0011205	excessive folding of visceral yolk sac	the appearance of wrinkles or folds on the surface of the visceral yolk sac
HP:0003202	Skeletal muscle atrophy	MP:0014068	abnormal muscle glycogen level	the normal concentration of a readily converted carbohydrate reserve in muscle tissue
HP:0000023	Inguinal hernia	MP:0010146	umbilical hernia	an outward bulging (protrusion) of the abdominal lining or part of the abdominal organ(s) through the area around the umbilicus; occurs when the muscle through which blood vessels pass to feed the developing fetus fails to completely close
HP:0007720	Flat cornea	MP:0005543	decreased cornea thickness	decreased thickness of the cornea, the transparent anterior portion of the fibrous coat of the eye that serves as the chief refractory structure
HP:0000541	Retinal detachment	MP:0003099	retinal detachment	detachment of the retina from the underlying inner wall of the eye, often from tension of the vitreous; may occur with aging or as a result of trauma
HP:0001083	Ectopia lentis	MP:0005263	ectopia lentis	congenital displacement of the lens due to defective zonule formation
HP:0005294	Arterial dissection	MP:0004044	aortic dissection	a pathologic process, characterized by splitting of the media layer of the aorta, which leads to formation of a dissecting aneurysm
HP:0001634	Mitral valve prolapse	MP:0010617	thick mitral valve cusps	an increase in the ratio of the mitral valve cusp wall thickness to the atrioventricular septum thickness
HP:0001252	Muscular hypotonia	MP:0004144	hypotonia	decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness
HP:0004933	Ascending aortic dissection	MP:0004044	aortic dissection	a pathologic process, characterized by splitting of the media layer of the aorta, which leads to formation of a dissecting aneurysm
HP:0007800	Increased axial globe length	MP:0004686	decreased length of long bones	reduced end-to-end length of the several elongated bones of the extremities
HP:0007018	Attention deficit hyperactivity disorder	MP:0001399	hyperactivity	general restlessness or excessive movement; more frequent movement from one place to another or having an increased state of activity
HP:0007676	Hypoplasia of the iris	MP:0011481	anterior iris synechia	adhesion of the iris to the cornea
HP:0001635	Congestive heart failure	MP:0011925	abnormal heart echocardiography feature	any anomaly in echocardiographic representation of systolic and diastolic function, ventricular compliance, valvular function, or interventricular septum features

Mapped by homologous gene(Total Items:53)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0001252	Muscular hypotonia	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0002650	Scoliosis	MP:0020309	increased creatine kinase activity	increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0000278	Retrognathia	MP:0020157	abnormal behavioral response to alcohol	any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior
HP:0001634	Mitral valve prolapse	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0000268	Dolichocephaly	MP:0020309	increased creatine kinase activity	increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0000275	Narrow face	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0003202	Skeletal muscle atrophy	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0003179	Protrusio acetabuli	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0005294	Arterial dissection	MP:0011575	dilated aorta bulb	the luminal space of the aorta bulb is increased in volume or area, usually with an increase of contained fluid
HP:0004326	Cachexia	MP:0013659	abnormal erythroid lineage cell morphology	any structural anomaly of an immature or mature cell in the lineage leading to and including erythrocytes
HP:0007676	Hypoplasia of the iris	MP:0014164	abnormal ciliary process morphology	any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter
HP:0003302	Spondylolisthesis	MP:0020010	decreased bone mineral density of femur	reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh
HP:0000347	Micrognathia	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0007018	Attention deficit hyperactivity disorder	MP:0020169	increased thyroid gland weight	higher than average weight of the thyroid gland
HP:0002360	Sleep disturbance	MP:0020169	increased thyroid gland weight	higher than average weight of the thyroid gland
HP:0006687	Aortic tortuosity	MP:0011309	abnormal kidney arterial blood vessel morphology	any structural anomaly of the network of tubes that supply blood to the renal tissues
HP:0002435	Meningocele	MP:0013349	small Rathke's pouch	reduced size of the pouch of ectoderm which grows out from the upper surface of the embryonic stomodeum and gives rise to the anterior and intermediate lobes of the pituitary gland
HP:0002097	Emphysema	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0002705	High, narrow palate	MP:0013600	testis degeneration	a retrogressive impairment of function or destruction of either or both of the male reproductive glands
HP:0000501	Glaucoma	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000541	Retinal detachment	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0100775	Dural ectasia	MP:0012125	decreased bronchoconstrictive response	reduction in the expected bronchoconstrictive response to provocation challenge with lipopolysaccharide, bradykinin, histamine or other antigen/allergen or agent, often measured by plethysmography
HP:0000938	Osteopenia	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0000939	Osteoporosis	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0004927	Pulmonary artery dilatation	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0004382	Mitral valve calcification	MP:0011108	embryonic lethality during organogenesis, incomplete penetrance	the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14)
HP:0002105	Hemoptysis	MP:0011098	embryonic lethality during organogenesis, complete penetrance	death of all organisms of a given genotype in a population between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14)
HP:0012019	Lens luxation	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0000768	Pectus carinatum	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0001065	Striae distensae	MP:0020039	increased bone ossification	increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance
HP:0000767	Pectus excavatum	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0007720	Flat cornea	MP:0011108	embryonic lethality during organogenesis, incomplete penetrance	the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14)
HP:0000175	Cleft palate	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0002108	Spontaneous pneumothorax	MP:0012431	increased lymphoma incidence	greater than the expected number of neoplasms characterized by a proliferation of malignant lymphocytes in lymphoid tissue in a specific population in a given time period
HP:0001382	Joint hypermobility	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0010807	Open bite	MP:0013696	increased granulocyte monocyte progenitor cell number	increase in the number of a hematopoietic progenitor cell that is committed to the granulocyte and monocyte lineages; these cells are CD123-positive, and do not express Gata1 or Gata2 but do express C/EBPa, and Pu.1
HP:0003326	Myalgia	MP:0020309	increased creatine kinase activity	increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0000494	Downslanted palpebral fissures	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0001533	Slender build	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0004933	Ascending aortic dissection	MP:0012125	decreased bronchoconstrictive response	reduction in the expected bronchoconstrictive response to provocation challenge with lipopolysaccharide, bradykinin, histamine or other antigen/allergen or agent, often measured by plethysmography
HP:0001166	Arachnodactyly	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0001635	Congestive heart failure	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0002996	Limited elbow movement	MP:0014164	abnormal ciliary process morphology	any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter
HP:0000545	Myopia	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0005111	Dilatation of the ascending aorta	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000678	Dental crowding	MP:0020309	increased creatine kinase activity	increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0000023	Inguinal hernia	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0001763	Pes planus	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0007800	Increased axial globe length	MP:0012106	impaired exercise endurance	impaired performance during controlled physical activity
HP:0002808	Kyphosis	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0000505	Visual impairment	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0001083	Ectopia lentis	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0001519	Disproportionate tall stature	MP:0014179	abnormal blood-retinal barrier function	anomaly in the function of the part of the blood-ocular barrier that consists of cells that are joined tightly together to prevent certain substances from entering the tissue of the retina; the BRB consists of non-fenestrated capillaries of the retinal ci

Disease ID	139
Disease	marfan syndrome
Case	(Waiting for update.)